circad | circRNAs associated with diseases

hsa_circ_092516
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Rheumatoid Arthritis	ICD-10	Rheumatoid arthritis, unspecified (M06.9)
DBLink	Link to database	PMID	28618429
Experimental Method
Sample Type	Peripheral Blood Mononuclear Cells (PBMCs)	Comparison	Peripheral Blood Mononuclear Cells (PBMCs) from 5 Rheumatoid Arthritis (RA) patients and 5 healthy controls
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTTCCTTACCAGCCTCCCTTT Reverse TGAAGAGTCAATACCGCCAGA	Statistics	Fold Change : Upregulated,1.639 pvalue : p<0.001
Citation
Ouyang, Q, Wu, J, Jiang, Z, Zhao, J, Wang, R, Lou, A, Zhu, D, Shi, GP, Yang, M (2017). Microarray Expression Profile of Circular RNAs in Peripheral Blood Mononuclear Cells from Rheumatoid Arthritis Patients. Cell. Physiol. Biochem., 42, 2:651-659.